qPCR was performed with StepOne Real-time PCR systems (ABI, USA) in a reaction volume

of 20 μl containing 2 μl of cDNA, 0.8 μl of forward primer (10 nM), 0.8 μl of reverse primer (10 nM), 10 μl of SYBR CAL-101 chemical structure Green Realtime PCR Master Mix (Toyobo, Japan) and 6.4 μl of ddH2O. The qPCR was processed at 95°C for 60 s, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s (data collection). All the qPCR reactions were performed in triplicate. The analysis of qPCR was carried out using the 2-ΔΔCt method. β-actin was taken as the internal control. The nucleotide sequences of the primers were listed in Table 1. All the primers were synthesized by Shanghai Sangon Biological Engineering & Technology and Service Co. Ltd, China. Table 1 PCR primers used in the experiments Target mRNA Primer sequences 5′-3′ Product Size (bp) Gene Bank Accession No RGC-32 sense TGCCAGAGGGGACAAAGAC 127 NM_014059.2 RGC-32 antisense GCAAGCAGGTAAACAAAGTCAG     E-cadherin sense ACAGCCCCGCCTTATGATTCTC 140 NM_004360.3 E-cadherin antisense AAGCGATTGCCCCATTCGTT     I-BET-762 purchase vimentin sense CCTTGAACGCAAAGTGGAATC 106 NM_003380.3 vimenin antisense GACATGCTGTTCCTGAATCTGAG     β-actin sense GTTGCGTTACACCCTTTCTTG 157 NM_001101.3 β-actin antisense GACTGCTGTCACCTTCACCGT     Western blot

Total protein extraction from BxPC-3 cells and western blot analysis was performed following the protocol as described previously [20]. Briefly, 80 μg of cell protein was eletrophoresed on a 12% SDS/polyacrylamide gel in Tris-glycin buffer and

transferred to nitrocellulose membranes. The nitrocellulose membranes were then blocked at room temperature for 2 h in buy AMN-107 blocking buffer (5% skim milk in TBST) and incubated with RGC-32 antibody (diluted 1:200), E-cadherin antibody 4-Aminobutyrate aminotransferase (diluted 1:400) and vimentin antibody (ProteinTech Group, Inc., USA, diluted 1:1000) respectively overnight at 4°C with β-actin antibody (ProteinTech Group, Inc., USA, diluted 1:1000) as control. Washed thrice with TBST, nitrocellulose membranes were incubated in HRP-conjugated goat anti-rabbit secondary antibody (Boster, China, diluted 1:3000) for 1 h at room temperature. Extensive washed with TBST, the complex was detected by Super Signal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific Inc, USA) according to the manufacturer’s instructions. Blot was scanned and densitometric analysis was done by Image J software (National Institutes of Health, USA). Transwell cell migration assay BxPC-3 cells were transfected with RGC-32 siRNA or the negative control siRNA and treated with 10 ng/ml TGF-β1 or not as described above. 24 h later, the cells were trypsinized, adjusted to 1 × 106/ml in RPMI-1640 medium, and 200 μl of the resuspended cell solution was added to the top chamber of 24-well transwell plates. The bottom chamber was filled with 600 μl of RPMI-1640 medium containing 10% FBS.