Further studies are needed to determine the mechanism of regulation that inhibits Sμ to Sμ trans-recombination and whether translocations between other downstream

S regions are also under similar regulation. Such regulation could also imply that it might be possible Erlotinib solubility dmso to manipulate the capacity of a DNA sequence to act as a site of chromosomal recombination and translocation. Taken together, our results indicate that upon B-cell stimulation, multiple AID-induced pathways can be activated that can lead to DNA recombination events involving both cis- and trans-CSR and that these processes appear to be regulated to maximize the diversity of B-cell responses to antigens. All experiments with mice were approved by and performed in accordance with the regulations of the Tufts University School of Medicine IACUC. The VV29 transgenic mice and AID knockout mice have been described elsewhere 4, 21, 29. The VV29 and AID−/− mice were crossed to generate VV29:AID−/− mice. AID knockout mice were obtained from Thereza Imanishi-Kari (Tufts University Ceritinib School of Medicine, Boston, MA) with permission from T. Honjo (Kyoto University, Kyoto, Japan). All mice were maintained in a pathogen-free mouse facility at Tufts University School of Medicine. Mice received four intraperitoneal (i.p.) immunizations with p-Ars conjugated to KLH as described previously 29, 30. For each genotype, a cohort of at least five mice was used

for each immunization. Total RNA was isolated with TRIzol following the manufacturer’s protocol (Invitrogen).

One microgram of RNA was used for cDNA synthesis using oligo(dT)20 and SuperScript III as recommended by the manufacturer (Invitrogen). The cDNA was Teicoplanin used for PCR amplification of Cγ transcripts using CγRI reverse primer, which hybridizes to the CH1 exon of either Cγ1, Cγ2a, or Cγ2b 29, 31, and forward primer L3RI, which hybridizes to the Leader exon of both the VV29 transgene V genes 31 and up to ten endogenous V genes (see Semi-quantitative PCR). For amplification of transgene-specific Cμ transcripts (VV29-Cμ), a transgene specific forward primer, TND (also used as a probe, see Southern blots) 30, and Cμ4R reverse primer (located on exon 4 of the Cμ gene, 5′TGGACTTGTCCACGGTCCTCT) were used. Amplification of endogenous Cμ transcripts was performed with a forward Cμ1F primer (located on exon 1 of the Cμ gene 5′GTCAGTCCTTCCCAAATG) and the Cμ4R primer. The PCR conditions for VV29-Cμ transcripts were 55°C annealing temperature for 30 s and 72°C extension temperature for 1.5 min for 35 cycles. For some samples, the RNA was DNase I treated prior to the cDNA synthesis as described by the manufacturer (Invitrogen). As loading controls, or for DNA contamination controls, RT-PCR amplification of β-actin was performed using β-actin forward (5′AGACTTCGAGCAGGAGATGG) and β-actin reverse (5′CACAGAGTACTTGCGCTCAG) primers at 55°C annealing temperature for 30 s and 72°C extension temperature for 1 min for 35 cycles.