The densities of immunoblot bands were analyzed using ImageJ computer software (NIH). Two methods were used. An Amaxa Nucleofector (Lonza Group, Ltd., Switzerland) was used according to the instructions to produce transient transfections of human embryonic kidney cells (HEK293 cells; American Type Culture Collection, Manassas, VA). Five micrograms of DNA were used per 1 × 106 cells in 100 μL of Nucleofector solution. see more Program Q-001

was used for the HEK293 cells. The stable cell line was produced using FuGENE reagent (Roche). Cells were plated on six-well plates and transfected with 1 μg DNA (pcDNA3 with appropriate insert) using 4 μL of FuGENE reagent in 2 mL of Dulbecco’s modified Eagle medium (DMEM) + 10% fetal bovine serum (FBS). After 48 hours, G418 was added to select the stable clones. The expression of each GPCR was confirmed by immunofluorescence staining followed by confocal microscopy. For GFP-S1P1 and GFP-S1P2, cells were inspected for GFP fluorescence and sorted by flow cytometry. The stable clones of each GPCR and vector only were maintained in culture medium containing G418 (100 μg/mL). The lentiviral selleck compound vectors containing the stem loop sequences of shRNA specifically targeting the rat S1P2 and scrambled control sequence were a gift from

Murthy Karnam (Department of Physiology and Biophysics, Virginia Commonwealth University, Richmond, VA). The BCKDHA silencing efficiency of each shRNA was confirmed by western blot analysis in HEK293 cell–transfected myc-tagged rat S1P2 using myc antibody as reported.29 The sequences for control shRNA and S1P2-shRNA used in this study were as follows: control shRNA: TCCTAAGGTTAAGTCGCCCTCG; S1P2-shRNA: AGGAACAGCAAG TTCTACTCA. The recombinant lentiviruses were produced

by transient transfection of HEK293FT cells (Invitrogen) using FuGENE (Roche). Briefly, HEK293FT cells were cultured in high-glucose DMEM, supplemented with 10% FBS, penicillin/streptomycin (100 U/mL), 0.1 mM nonessential amino acids, and 500 μg/mL of G418. The subconfluent cells in a 10-cm culture dish were cotransfected with lentiviral vector (5 μg), the lentiviral packaging vectors pRSV-REV (1.25 μg) and pMDLg/pRRE (2.5 μg), and the vesicular stomatitis virus G glycoprotein (VSVG) expression vector pMD2G (1.5 μg). The viruses were collected from the culture supernatants on day 3 after transfection, passed through a 22-gauge needle, and centrifuged at 350 g for 7 minutes. The supernatants were then centrifuged at 80,000 g for 90 minutes at 4°C, and the pellet was resuspended in 50 μL PBS. Titers were determined by infecting HEK293FT cells in a 24-well plate with serial dilutions of concentrated lentivirus, and counting enhanced (E)GFP-expressing cells after 48 hours under fluorescent microscopy (transfecting units per mL = number of cells × dilution × 100).